|
Proteintech
anti rcor1 Anti Rcor1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti rcor1/product/Proteintech Average 93 stars, based on 1 article reviews
anti rcor1 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Eurofins Genomics
30 primer for cloning lsd1 protein (aa 852) into pleics12 vector: gacggagctcgaatttcaca tgcttggggactgctgtgc 30 Primer For Cloning Lsd1 Protein (Aa 852) Into Pleics12 Vector: Gacggagctcgaatttcaca Tgcttggggactgctgtgc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/30 primer for cloning lsd1 protein (aa 852) into pleics12 vector: gacggagctcgaatttcaca tgcttggggactgctgtgc/product/Eurofins Genomics Average 90 stars, based on 1 article reviews
30 primer for cloning lsd1 protein (aa 852) into pleics12 vector: gacggagctcgaatttcaca tgcttggggactgctgtgc - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
NeuroMab
corest recombinant fusion protein to a region of human co-rest ![]() Corest Recombinant Fusion Protein To A Region Of Human Co Rest, supplied by NeuroMab, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/corest recombinant fusion protein to a region of human co-rest/product/NeuroMab Average 90 stars, based on 1 article reviews
corest recombinant fusion protein to a region of human co-rest - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
RCOR1/CoREST Recombinant Protein Antigen
|
Buy from Supplier |
Image Search Results
Journal: The Journal of comparative neurology
Article Title: Dissecting LSD1-Dependent Neuronal Maturation in the Olfactory Epithelium
doi: 10.1002/cne.24259
Figure Lengend Snippet: Antibodies used in this study
Article Snippet: Information on the antibodies is derived from the manufacturers’ description, the literature, and our own data. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Primary Antibody Immunogen Source, species, clonality, catalog#, RRID Dilution, staining protocol beta-actin Beta-actin N-terminal peptide ThermoFisher, mouse monoclonal, cat # MA5–15739 (clone BA3R), RRID: AB_10979409 1:1,000 for Western blot beta-gal Bacterial beta-galactosidase Abcam, chicken polyclonal, cat # ab9361, RRID: AB_307210 1:750 directly conjugated (5 min trypsin digest) CK14 Recombinant human KRT14 Proteintech, rabbit polyclonal, cat # 10143–1-AP, RRID: AB_2134831 1:1,000 directly conjugated (5 min 3% H 2 O 2 in methanol + 10 min steam) CoREST Recombinant fusion protein to a region of
Techniques: Staining, Western Blot, Recombinant, Serial Time-encoded Amplified Microscopy, Sequencing